MS-Access-2003: VBA Module Coding - opearting via Macro :
I have an Array that runs and at the end it gives a Pop-Up Box that shows either an Error with Error # or it will show Completed w...
Hello,
I have 3 boxes/fields in a search form. I can perform a search by filling out 1 field, 2 fields or all 3 of them.
The fields are
1 combo box (I can select a country, say Canada...
I have a couple reports that are modified by VB code onload to populate titles and other fields. Because this changes the report each time its opened I get prompted to save the report when I ...
I have the attached code in Access 2003 VB which which creates a record set, loops through it and creates and sends excel spreadsheets as email attachments. The excel attachements are created...
I have a count query that works fine. The user runs and it produces a count in the query grid.
However, displaying the count in a query grid does not give my application a polished look. I ...
I have a text tile containing strings of text in the following format:
>ATIEA01TF
GTTCTTAATTACAACTGCCAAAAATAGTTGACCGGAGTTGTGTTCTTTTTTTTTGTCGAA
CCGGAGTTGTGTTCAATGTCAATATATGTGAACTGTTGACAAAA...
Hi, I have a make table query [qryOutput] in Access that filters results when a user chooses the criteria. When the form [assessment] filters the data I would like a command button on it to ex...
hi, i am using m2sys biometrics m2s1scanner,the problem now is if the fingerprint scanner is not connected, we can manually press a hot key & can manually give username &password , now i want ...
I have a msg box coming up in a form, however the text i have in it is too long and would like to wrap it so to make the box smaller. in my code i have tried to press enter to have 2 lines of ...
Programming an interface in Microsoft access. Using vba. Windows vista.
Hi I need to export a query to excel template and this template has to be refreshed by any query that I want to do everytime.
There are 2 tab, one with raw data and the second with pivot tabl...
What is OPTION COMPARE DATABASE
http://support.microsoft.com/kb/98227 Here is the KB article on this but it still doesn't explain it well.
I noticed in the MS Access Menu Tools-> Option...
Hi experts,
I'm trying to insert records from tbl_A to tbl_B. Each record in tbl_B contains a unique caseID. I want to prompt an error message if any of the records in tbl_A that I want to ...
I know I am close and I have searched the internet and tried several different tutorials and coded them like the tutorial shows, but I just doesn't work. I have no idea why...
Hi. I have a form with an attached subform. form has an InspEndDate and subform has a ShipRcptDate. I'm trying to count days between the ShipRcptDate and the InspEndDate and dropping the co...
tblMain.JobNo has an auto generated number in groups. Sometimes some groups get out of sequence as shown below. I need to re-order these groups in order to put them in sequence. Any assistance...
Hi!!!
I've been searching this site for about 3 days now trying to get my problem solved. Here's the situation: I have a combo box that I want to populate 2 other text boxes. I got the c...
Hi,
I am trying to write some code for a form with pull down combobox and a subform in Access 2003. The subform is a datasheet. The pull down combobox contains a list of groups and the dat...
I've pasted my SAP GUI script into a Microsoft Access module. the script works if I run the .VBS file from my desktop, but when I try to run from within Access, I get a comile error 'Method o...
Okay, here's the scenario:
Each record has a Primary account number. Some records can have additional account numbers which the user will add to a listbox.
What's the best way to store ...
Hi,
I am designing a database in access 2007 that creates timesheets based on time entered into the database. I have created a form that will allow for a report to be generated for each tec...
I need to append data from a table to a text file that has already been created with a DoCmd method. Here is that
DoCmd.TransferText acExportFixed, "EXPORT_TABLE_Export_Specification", "EXPO...
I'm creating my database form so it automatically opens and disables in all the 'usual' access controls from the user.
I use the center-form property in the access window, however it doesn'...
I can set focus to highlight the contents of a text box.
What statemets can be used to copy the contents to the clip board?
Thanks,
Hi, I have an Access DB which is used as a survey and reporting(Aggregated data of the survey) tool. On the report side, i have a button that once clicked it invokes the macro which populates ...
