how to apply a loaded properties class to a piece of text

Hall of Fame

1. objects2,187,515
2. CEHJ1,517,516
3. mwvisa1229,345
4. a_b228,003
5. ksivananth193,959
6. basav_com137,179
7. mrjoltcola119,666
8. Thomas4...112,534
9. gibu_geo...94,983
10. jim_cakalic82,790
11. sciuriware76,102
12. fsze8875,772
13. Christofer...67,138
14. Interactive...56,592
15. dravidnsr56,064
16. bluebelldis...55,751
17. ozlevanon54,968
18. Kuldeepc...42,700
19. Bart_Cr41,380
20. n_sachin140,200
21. gurvinder...36,417
22. mrcoffee...35,716
23. Venabili34,708
24. rpnman33,424
25. rrz@87...31,244

1. objects12,161,098
2. CEHJ10,123,509
3. zzynx1,630,526
4. mayankea...1,438,443
5. TimYates1,342,245
6. sciuriware1,132,073
7. girionis1,022,287
8. ksivananth793,750
9. Ajay-Singh791,585
10. heyhey_515,764
11. jim_cakalic504,446
12. aozarov483,814
13. mwvisa1471,782
14. Javatm456,951
15. orangehe...393,681
16. hoomanv378,789
17. Webstorm359,422
18. sudhakar...351,968
19. bloodredsun321,737
20. cmalakar312,277
21. StillUnAw...300,197
22. suprapto45295,202
23. petmagdy288,188
24. Giant2287,095
25. contactka...265,356

	[x] Posted via EE Mobile
	Search, ask, and monitor your questions on the go with EE Mobile. Visit Experts Exchange from your mobile device and never be out of touch again.

Question

	[x] Attachment Details

[x]

The Solution Rating System

With so many solutions, how can you tell which solutions are most likely to help you and which ones are not? To provide you with a tool to use, we rate our solutions based on various elements that most accurately determine if a solution is a quality solution. To explain what factors affect the solution rating, here are the elements we take into consideration when formulating our solution rating.

The Grade of the Solution
The Zone Rank of the Expert Providing the Solution
The Number of Author and Expert Comments
The Number of Experts Contributing
The Feedback of the Community

Your Input Matters
Because of the way the system is set up, the most important variable in this equation is you. As a member of Experts Exchange, you are able to cast your vote on the quality of the solutions in regard to how complete, accurate, helpful and easy to understand each solution is. When you provide your feedback, each rating is adjusted accordingly. So, if you see a solution that has a poor rating that you think is a good solution, let us know by rating it. As you do, the rating will be adjusted and will become more accurate for other members of our site.

If you have any suggestions that you would like to make for our rating system, please ask a question in the Suggestions Zone of Community Support.

Thank you!

5.8

how to apply a loaded properties class to a piece of text

Asked by tigabalm in Java Programming Language, Java Standard Edition, Delphi Components

ok so i finished my translate class:

//This class holds the genome/protein conversion through the use of a properties map.

public class Translate{
//Instance of a properties class which holds the key for the translation tbale
private Properties props = new Properties();
//private FileInputStream inStream = new FileInputStream("codes.properties");
// private File inFile
//this method loads the key and then our read/write class can call this to translate the input file
//@param InputStream the properties file that holds the translation table
public void load(InputStream in) throws IOException{
// GetFile get = new GetFile();
// get.openFile(inFile);

//need to load in the properties class
props.load(new FileInputStream("codes.properties"));
}
//the method that gets a Protein code
//@param code the protein code that we are looking for
public String getProtein(String code){
return (String) props.get(code);
}

}
---------
now i would like to have props be applied to an input file so that it could translate it,

what would be the best way to go about doing this?

IE: my loaded proprs looks like:

GCT=A
GCC=A
GCA=A
GCG=A
----------
and i would like it to translate:

ATTGGCTCTTACCACTTGTCCCTCAAAACGACCACCCCATTGACTGGTGGCGATTGCGTCGACGGAGACG
GGGCAAAAGCAAGCTGAACCCGAAAAATAACAAACACTGGGGCTGAGGGGTGGAACTACGAGTGCGCAGA

i'd appreciate any help!

thanks

peace

View the Solution FREE for 30 Days

20091021-EE-VQP-81

how to apply a loaded properties class to a piece of text

Asked by tigabalm in Java Programming Language, Java Standard Edition, Delphi Components

About this solution