its me again objects (the guy with the DNA translation program)
trying to figure out how to apply the properties to the DNA code file
peace
Main Topics
Browse All Topics
Loading Advertisement...
Question
translating code through use of properties class
ok so i have a properties class and an inputStream
wondering how to sort/parse/translate the inputStream according to the loaded properties object?
i'd appreciate all the help i can get!
thanks
peace
This Question has been solved and asker verified All Experts Exchange premium technology solutions are available to subscription members.
Subscribe now for full access to Experts Exchange and get
Instant Access to this Solution
- Plus...
- 30 Day FREE access, no risk, no obligation
- Collaborate with the world's top tech experts
- Unlimited access to our exclusive solution database
- Never be left without tech help again
Trusted by hundreds of thousands everyday for fast, accurate and reliable tech support.
- "The time we save is the biggest benefit of Experts Exchange to Warner Bros. What could take multiple guys 2 hours or more each to find is accessed in around 15 minutes on Experts Exchange." Mike Kapnisakis, Warner Bros.
- "Our team likes having a resource that is more secure than just using Google and most experts using this service really know their stuff. It's nice to look here first versus using Google." Dayna Sellner, Lockheed Martin
- "Anytime that I've been stumped with a problem, 9 out of 10 times Experts Exchange has either the accepted solution or an open discussion of the potential solution to the problem." Kenny Red, eBay Inc.
See what Experts Exchange can do for you.
Got a question?
We've got the answer.
Experts Exchange has been collecting answers to technology questions since 1996…3 million and counting! If you have a question, chances are we already have your answer.
Need individual assistance?
Our experts are ready to help.
If you can't find the exact answer you're looking for, ask our exclusive community of 50,000 experts. You’ll get a personalized answer from a trusted professional.
Want to learn from the best?
Read articles from industry experts.
Thousands of free tech tips, tricks, how-to’s and tutorials are available in our peer reviewed articles section. See for yourself how smart our experts are, no login required.
Working on a long term project?
Store your work and research.
Save solutions to your questions, answers you’ve discovered through searching plus helpful articles in your personal knowledgebase for easy future access.
Access the answers to your technology questions today.
30-day free trial. Register in 60 seconds.
What Makes Experts Exchange Unique?
Members of the expert community talk about why the experience at Experts Exchange is different than what you will find anywhere else.
Trusted by the world's most respected brands.
Faithfully serving IT professionals since 1996.
Try it out and discover for yourself.
30-day free trial. Register in 60 seconds.
Free Tech Articles
-
WARNING: 5 Reasons why you should NEVER fix a computer for free.
It is in our nature to love the puzzle. We are obsessed. The lot of us. We love puzzles. We love the challenge. We thrive on finding the answer. We hate disarray. It bothers us deep in our soul. W...
-
SCCM OSD Basic troubleshooting
SCCM 2007 OSD is a fantastic way to deploy operating systems, however, like most things SCCM issues can sometimes be difficult to resolve due to the sheer volume of logs to sift through and the dispe...
-
Migrate Small Business Server 2003 to Exchange 2010 and Windows 2008 R2
This guide is intended to provide step by step instructions on how to migrate from Small Business Server 2003 to Windows 2008 R2 with Exchange 2010. For this migration to work you will need the fo...
-
Create a Win7 Gadget
This article shows you how to create a simple "Gadget" -- a sort of mini-application supported by Windows 7 and Vista. Gadgets can be dropped anywhere on the desktop to provide instant information, ...
-
Outlook continually prompting for username and password
There have been a lot of questions recently regarding Outlook prompting for a username and password whilst using Exchange 2007. There are a few reasons why this would happen and I will try to cover t...
-
Backup Exchange 2010 Information Store using Windows Backup
There seems to be quite a lot of confusion around the ability to backup Exchange 2010 using the built in Windows Backup feature. This stems from the omission of this feature prior to Exchange 2007 s...
Cloud Class Webinars
- Avoiding Bugs in Microsoft Access
Alison Balter takes and in-depth look at avoiding bugs in Access. In this webinar you will learn about using the immediate window to debug your applications, invoking the debugger, using breakpoints to troubleshoot, stepping through code, setting the next statement to execute, ...
- Top 10 Best New Features in Visio 2010
Scott Helmers gives live demonstrations of the top 10 new features in Visio 2010. This webinar will teach you how to create compelling diagrams by adding shapes to the page with a single click, linking the shapes in a diagram to data in Excel (or SQL Server, or SharePoint), ...
- IT Consultant Business Secrets Revealed
Michael Munger, Experts Exchange tech pro and IT consultant, pulls back the curtain on his very successful businesses and answers question on every IT consultant and business owner should know about. He shares secrets on what he did to solve the 5 most common problems in IT, ...
- Disaster Recovery and Business Continuity
Quest CTO, Mike Billon, gives an overview of the steps involved in building a dunamic disaster recovery plan. Through case studies and an examination of software/hardware tooles for monitoring and testing, you'll gain a better understandin of where you are, where you want ...
- Organize Your Visio Diagrams with Containers and Lists
Scott Helmers uses cross functional flowcharts, wireframe diagrams, data graphic legends and seating charts to teach you: how to ustilize all three new structured diagram components in Visio 2010, the best practices for organizeing shapes in previous version of Visio, how to organize ...
- How to Us Objects, Properties, Events and Methods in Microsoft Access
Alison Dalter gives an in-depbth look at objects, properties, events and methods in Microsoft Access. In this webinar you will learn about using the object browser, referring to objects, working with properties and methods, working with object variables, understanding the ...
Join the Community
Give a Little. Get a Lot.
Join the community of experts here and help other tech pros by answering question in your area of expertise. You can earn FREE access to all Experts Exchange's premium features and resources.
Answers
well my translate class is:
import java.util.*;
import java.awt.*;
import java.awt.event.*;
import java.io.*;
import javax.swing.*;
//This class holds the genome/protein conversion through the use of a properties map.
public class Translate{
//Instance of a properties class which holds the key for the translation tbale
private Properties props = new Properties();
private File inFile;
//this method loads the key and then our read/write class can call this to translate the input file
//@param InputStream the properties file that holds the translation table
public void load(InputStream in) throws IOException{
//need to load in the properties class
props.load(new FileInputStream("codes.pro
}
//This method actually translates the separated file though the use of a while loop that parses through the file
//@param inFile the file that is separated
//@param in the properties object which holds the translation table
public void translate(File inFile, InputStream in){
Separate sep = new Separate();
//sep.separate(inFile) = separated;
//loop that translates the code
try {
BufferedReader inReader = new BufferedReader(new FileReader("infilename"));
String str;
while ((str = inReader.readLine()) != null) {
}
inReader.close();
}
catch (IOException e) {
}
}
//the method that gets a Protein code
//@param code the protein code that we are looking for
public String getProtein(String code){
return (String) props.get(code);
}
}
------------------------
and my separate class is:
import java.awt.*;
import java.awt.event.*;
import java.io.*;
import javax.swing.*;
//This is the class the parses the DNA code into bits of three so it can be translated using the translation table
public class Separate {
private static File inFile;
private String line;
private int pos;
public Separate(){
}
//This method parses the DNA code into parts of three beginning at the first start code
public void separate(File inFile){
String triplet = line.substring(pos, pos+3);
pos += 3;
//line = reader.readLine();
}
public static void main(String[] args) {
GetFile g = new GetFile();
g.openFile(inFile);
}
its pretty ugly in both of those, but i was basically going through some trial and error...
thanks
peace
oh and sorry my getfile class is:
import java.awt.*;
import java.awt.event.*;
import java.io.*;
import javax.swing.*;
public class GetFile{
//private JButton openButton;
private FileInputStream input;
private String sourceFilename;
private File inFile;
private String line;
private int pos;
private Separate s;
public GetFile(){
openFile(inFile);
//inFile.close();
}
public static void main(String[] args){
new GetFile();
Separate s = new Separate();
}
public void openFile(File inFile){
JFileChooser fileChooser = new JFileChooser();
fileChooser.setFileSelecti
int result = fileChooser.showOpenDialog
if (result == JFileChooser.CANCEL_OPTION
return;
inFile = fileChooser.getSelectedFil
try{
input = new FileInputStream(inFile);
}
catch (IOException ioException){
JOptionPane.showMessageDia
}
try{
BufferedReader reader = new BufferedReader(new FileReader(inFile));
line = reader.readLine();
//System.out.println("The line : \"" +line+ "\"");
while(line!=null){
System.out.println("The next line is " +line);
// String triplet = line.substring(pos, pos+3);
// pos += 3;
// line = reader.readLine();
// System.out.println("The next line is \"" +line+ "\"");
// line = reader.readLine();
}
}
catch
(IOException exception) {
System.out.println("readLi
}
}
}
thanks
peace
your reading loop should look something like:
BufferedReader reader = new BufferedReader(new FileReader(inFile));
StringBuffer result = new StringBuffer();
while((line=in.readLine()!
System.out.println("The next line is " +line);
if (!line.startsWith(">"))
{
int pos = 0;
while (pos<line.length()-3)
{
String triplet = line.substring(pos, pos+3);
String symbol = properties.getProperty(sym
result.append(symbol);
pos += 3;
}
}
}
its still a "little" messy but should all be there:
import java.util.*;
import java.awt.*;
import java.awt.event.*;
import java.io.*;
import javax.swing.*;
//This class holds the genome/protein conversion through the use of a properties map.
public class Translate{
//Instance of a properties class which holds the key for the translation tbale
private Properties props = new Properties();
private File input;
private File inFile;
private InputStream in;
private String line;
private String symbol;
//this method loads the key and then our read/write class can call this to translate the input file
//@param InputStream the properties file that holds the translation table
public void load(InputStream in) throws IOException{
//need to load in the properties class
props.load(new FileInputStream("codes.pro
}
//This method actually translates the separated file
//@param inFile the file that is separated
//@param in the properties object which holds the translation table
public void translate(File inFile, InputStream in){
Separate sep = new Separate();
sep.separate(input);
// String string = props.getProperty("triplet
// props.setProperty("triplet
try{
BufferedReader reader = new BufferedReader(new FileReader(inFile));
StringBuffer resultFile = new StringBuffer();
while((line=reader.readLin
System.out.println("The next line is " +line);
if (!line.startsWith(">"))
{
int pos = 0;
while (pos<line.length()-3)
{
String triplet = line.substring(pos, pos+3);
String symbol = props.getProperty(symbol);
resultFile.append(symbol);
pos += 3;
}
}
}
}
catch (IOException exception) {
System.out.println("readLi
}
}
//the method that gets a Protein code
//@param code the protein code that we are looking for
public String getProtein(String code){
return (String) props.get(code);
}
thanks
peace
sorry mang... just had two midterms and brain is working so well....
but getting a null pointer exception at runtime...
can u just take a look at my two classes and see if you can find what is throwing it?
getFile class:
import java.awt.*;
import java.awt.event.*;
import java.io.*;
import javax.swing.*;
public class GetFile{
//private JButton openButton;
private FileInputStream input;
private FileInputStream inFile;
private String sourceFilename;
private File codes;
private String line;
private int pos;
private Separate s;
private File resultFile;
public GetFile(){
//openFile(inFile);
//inFile.close();
}
public static void main(String[] args){
new GetFile();
Separate s = new Separate();
}
public void openFile(File inFile){
JFileChooser fileChooser = new JFileChooser();
fileChooser.setFileSelecti
int result = fileChooser.showOpenDialog
if (result == JFileChooser.CANCEL_OPTION
return;
inFile = fileChooser.getSelectedFil
try{
input = new FileInputStream(inFile);
}
catch (IOException ioException){
JOptionPane.showMessageDia
}
__________________________
translate class:
import java.util.*;
import java.awt.*;
import java.awt.event.*;
import java.io.*;
import javax.swing.*;
//This class holds the genome/protein conversion through the use of a properties map.
public class Translate{
//Instance of a properties class which holds the key for the translation tbale
private Properties props = new Properties();
private File input;
private File inFile;
private InputStream in;
private String line;
private String symbol;
//this method loads the key and then our read/write class can call this to translate the input file
//@param InputStream the properties file that holds the translation table
public void load(InputStream in) throws IOException{
//need to load in the properties class
props.load(new FileInputStream("codes.pro
}
//This method actually translates the separated file
//@param inFile the file that is separated
//@param in the properties object which holds the translation table
public void translate(File inFile, InputStream in){
Separate sep = new Separate();
sep.separate(input);
// String string = props.getProperty("triplet
// props.setProperty("triplet
try{
BufferedReader reader = new BufferedReader(new FileReader(inFile));
StringBuffer resultFile = new StringBuffer();
while((line=reader.readLin
System.out.println("The next line is " +line);
if (!line.startsWith(">"))
{
int pos = 0;
while (pos<line.length()-3)
{
String triplet = line.substring(pos, pos+3);
String symbol = props.getProperty(triplet)
resultFile.append(symbol);
pos += 3;
}
}
}
}
catch (IOException exception) {
System.out.println("readLi
}
}
//the method that gets a Protein code
//@param code the protein code that we are looking for
public String getProtein(String code){
return (String) props.get(code);
}
}
thanks
peace
and then i am calling it like this:
import java.awt.*;
import java.awt.event.*;
import java.io.*;
import javax.swing.*;
//This class stores the gene information and translated information
public class Store{
private static File inFile;
private static Separate sep;
private static Translate t;
private static InputStream in;
private static File inputFile;
private static String translated;
public static void main(String[] args) {
try{
GetFile g = new GetFile();
g.openFile(inFile);
t.load(in);
t.translate(inputFile,in);
}
catch
(IOException exception) {
System.out.println("readLi
}
}
}
________________________
i think it is because the t.translate isnt getting anything... so how do i connect the FileInputStream from getFile to the inputFile in translate?
thanks a bunch man!
peace
man... now i get a null pointerexception... it gets past t.load(in)... but i dont htink its getting anything from the "inputFile"
i was looking through my code... and i dont think the file from getFile is linked to the inputFile in separate... therefore when translate runs... its not getting anything to translate...
thanks
peace
sorry would prolly help if i posted the Separate class:
import java.awt.*;
import java.awt.event.*;
import java.io.*;
import javax.swing.*;
//This is the class the parses the DNA code into bits of three so it can be translated using the translation table
public class Separate {
private static File inFile;
private String line;
private int pos;
public Separate(){
}
//This method parses the DNA code into parts of three beginning at the first start code
public void separate(File inFile){
GetFile get = new GetFile();
get.openFile(inFile);
int pos = 0;
while (pos<line.length()-3)
{
String triplet = line.substring(pos, pos+3);
System.out.println(triplet
}
//line = reader.readLine();
}
// public static void main(String[] args) {
// GetFile g = new GetFile();
// g.openFile(inFile);
//String triplets = "ATTGGCTCTTACCACTTGTCCCTCA
// TripletReader tr = new TripletReader(new FileReader(inFile));
// String code = null;
// while((code = tr.readNextCode()) != null) {
// System.out.println(code);
// }
// tr.close();
// }
// catch(Exception e) {
// e.printStackTrace();
// }
}
//}
//class TripletReader {
//
// private Reader in;
// private char[] codeBuffer;
//
// public TripletReader(Reader in) {
// this.in = in;
// codeBuffer = new char[3];
// }
//
// public String readNextCode() throws IOException {
// String code = null;
// int charsRead = in.read(codeBuffer);
// if (charsRead == 3) {
// code = new String(codeBuffer);
// }
// else if (charsRead < 0) {
// in.close();
// }
// else if (charsRead < 3) {
// throw new EOFException("Incorrect number of characters in source file");
// }
// return code;
//
// }
//
// public void close() {
// try { in.close(); } catch(IOException e) { /* ignore */ }
// }
//}
--------------------------
thanks
peace
thats exactly what i just thought...
what i wanted it to do was to separate an input file... then the translate class would take the separated file and apply codes.properties to the separated strings and then translate...
now i am thinking... either i combine separate() and translate()
or i have separate() save the separated file and then translate() will read the new file...
which would u suggest?
thanks
peace
public static void main(String[] args) {
try{
GetFile g = new GetFile();
g.openFile(inFile);
t = new Translate();
t.load(in);
System.out.println("got here");
t.translate(inFile,in);
System.out.println("got here");
----------
it prints "got here" and then throws the error... so i am assuming it the "t.translate(inFile,in);" since it doesnt print the second print statement
thanks
peace
no because ytou pass it to the translate method, you need to pass a valid File to translate.
Also in is not used so you can get rid of it.
translate will then look like:
public void translate(File inFile){
and you'll call it using something like:
File inFile = new File("xyz.properties");
t.translate(inFile);
you can also get rid of the following line
private File inFile;
ok so this is what my translate() method looks like now:
public void translate(File inFile, InputStream in){
// String string = props.getProperty("triplet
// props.setProperty("triplet
try{
GetFile g = new GetFile();
g.openFile(inFile);
System.out.println("going to translate");
BufferedReader reader = new BufferedReader(new FileReader(inFile));
StringBuffer resultFile = new StringBuffer();
System.out.println("readin
while((line=reader.readLin
System.out.println("The next line is " +line);
if (!line.startsWith(">"))
{
int pos = 0;
while (pos<line.length()-3)
{
String triplet = line.substring(pos, pos+3);
String symbol = props.getProperty(triplet)
resultFile.append(symbol);
pos += 3;
}
}
------------
i deleted inFile from the class so what should the "inFile" be in:
g.open(inFile);
and
BufferedReader reader = new BufferedReader(new FileReader(inFile));
thanks
peace
i'm finishing up about now sorry, may be back online tomorrow
otherwise monday
change GetFile to
public InputStream openFile() throws IOException {
JFileChooser fileChooser = new JFileChooser();
fileChooser.setFileSelecti
int result = fileChooser.showOpenDialog
if (result == JFileChooser.CANCEL_OPTION
return;
File inFile = fileChooser.getSelectedFil
input = new FileInputStream(inFile);
return input;
}
transtale to:
public void translate(InputStream in){
try{
System.out.println("going to translate");
BufferedReader reader = new BufferedReader(new InputStreamReader(in));
StringBuffer resultFile = new StringBuffer();
System.out.println("readin
while((line=reader.readLin
System.out.println("The next line is " +line);
if (!line.startsWith(">"))
{
int pos = 0;
while (pos<line.length()-3)
{
String triplet = line.substring(pos, pos+3);
String symbol = props.getProperty(triplet)
resultFile.append(symbol);
pos += 3;
}
}
and main to:
public static void main(String[] args) {
try{
GetFile g = new GetFile();
InputStream in = g.openFile();
t = new Translate();
t.load(in);
System.out.println("got here");
t.translate(g.openFile());
System.out.println("got here");
funny cause thats what i ended up doing... guess i am learning this stuff lol...
i'm so happy that i works!! one thing tho... when i run java Store... it opens two jfilechoosers... so that i'll select one file, and then instantly anothner filechooser window opens... and then afteri choose the 2nd one it starts translating...
but the other funny thing is that it just keeps running forever.... i let it run for like 5 minutes and it just kept spitting out the same translation over and over again....
do i need to close the file stream or something?
also could u help me with hamming distances? i opened up a new question...
thanks so much!!
peace
3 Ways to Join
Business Accounts
- Perfect for organizations
- Multiple users
- Save over 36%
- Create a Business Account
Answer for Membership
- Earn free access
- Showcase your knowledge
- No credit card required
- Sign Up to Answer
Loading Advertisement...
by: objectsPosted on 2005-02-16 at 18:43:39ID: 13331103
Whats in your stream?