Advertisement

01.25.2006 at 04:25AM PST, ID: 21709461
[x]
Attachment Details
[x]
The Solution Rating System

With so many solutions, how can you tell which solutions are most likely to help you and which ones are not? To provide you with a tool to use, we rate our solutions based on various elements that most accurately determine if a solution is a quality solution. To explain what factors affect the solution rating, here are the elements we take into consideration when formulating our solution rating.

  • The Grade of the Solution
  • The Zone Rank of the Expert Providing the Solution
  • The Number of Author and Expert Comments
  • The Number of Experts Contributing
  • The Feedback of the Community

Your Input Matters
Because of the way the system is set up, the most important variable in this equation is you. As a member of Experts Exchange, you are able to cast your vote on the quality of the solutions in regard to how complete, accurate, helpful and easy to understand each solution is. When you provide your feedback, each rating is adjusted accordingly. So, if you see a solution that has a poor rating that you think is a good solution, let us know by rating it. As you do, the rating will be adjusted and will become more accurate for other members of our site.

If you have any suggestions that you would like to make for our rating system, please ask a question in the Suggestions Zone of Community Support.

Thank you!

8.0

How to generate a series of strings?

Asked by mjcoyne in Perl Programming Language

Tags: , , ,

I have some DNA sequences represented by, for example, TAGAGGTCATTACAGCGAGAGGAANNNN.  The N's mean that any base (A, T, G, or C) can appear there.  Thus, this sequence is shorthand, and meant to represent a population of actual sequences:

TAGAGGTCATTACAGCGAGAGGAAAAAA
TAGAGGTCATTACAGCGAGAGGAAAAAT
TAGAGGTCATTACAGCGAGAGGAAAAAG
TAGAGGTCATTACAGCGAGAGGAAAAAC
TAGAGGTCATTACAGCGAGAGGAAAATA
TAGAGGTCATTACAGCGAGAGGAAAAGA
...

and so on, for all possible (which I believe would be 4^4 = 256 possibilities) values of N.

Given such a sequence, how can I generate the actual strings with Perl?Start Free Trial
[+][-]01.25.2006 at 04:51AM PST, ID: 15785433

View this solution now by starting your 7-day free trial. Setting up your free trial is quick, easy, and secure. We will return you to this solution, unlocked, when you're done.

 

About this solution

Zone: Perl Programming Language
Tags: all, generate, perl, series
Sign Up Now!
Solution Provided By: xanius
Participating Experts: 1
Solution Grade: A
 
 
[+][-]01.25.2006 at 11:52AM PST, ID: 15789570

Often, when Experts are collaborating with members who have asked questions, they will request additional information about the problem. Askers respond with an author comment like this one.

Start your 7-day free trial to view this Author Comment or ask the Experts your question.

 
[+][-]01.26.2006 at 12:57AM PST, ID: 15793447

At Experts Exchange, members can ask their questions to thousands of technology professionals, also known as Experts. Experts compete and collaborate to answer those questions by leaving comments like this one.

Start your 7-day free trial to view this Expert Comment or ask the Experts your question.

 
 
Loading Advertisement...
20080716-EE-VQP-32