[x]
Posted via EE Mobile

Search, ask, and monitor your questions on the go with EE Mobile. Visit Experts Exchange from your mobile device and never be out of touch again.

Question
[x]
Attachment Details

need help--Perl to extract encoding DNA

Asked by CRAZYCRAZY in Miscellaneous Programming, Perl Programming Language

Tags: programming, perl, bioinformatics

Hi everyone, I am new here. I wanner use perl to extract the encoding part of DNA. Our input will be a protein sequence and a DNA sequence. The protein sequence is encoded in the DNA sequence. For example: a protein sequence FICEDDPKQR is encoded in the
() part of the DNA sequence
ATGAAAATT(TTCATTTGCGAAGACGATCCAAAACAAAGA)GAAAACATGGTTACC
I wanner use Perl to extract the encoding part and save it into a new DNA sequence file.

Since the reverse translation of protein to DNA is a little complicated, I am wondering to translate our dna sequence in 3 reading frames to 3 new different protein sequences(I can write this script), then match with the input protein sequence. If match, then reverse the new match protein sequence to DNA sequence and extract it.
[+][-]11/06/09 11:57 AM, ID: 25762489Expert Comment

At Experts Exchange, members can ask their questions to thousands of technology professionals, also known as Experts. Experts compete and collaborate to answer those questions by leaving comments like this one.

Start your 30-day free trial to view this Expert Comment or ask the Experts your question.

 
[+][-]11/08/09 11:09 AM, ID: 25771450Expert Comment

At Experts Exchange, members can ask their questions to thousands of technology professionals, also known as Experts. Experts compete and collaborate to answer those questions by leaving comments like this one.

Start your 30-day free trial to view this Expert Comment or ask the Experts your question.

 
[+][-]11/08/09 06:11 PM, ID: 25773017Author Comment

Often, when Experts are collaborating with members who have asked questions, they will request additional information about the problem. Askers respond with an author comment like this one.

Start your 30-day free trial to view this Author Comment or ask the Experts your question.

 
 
Loading Advertisement...
20091021-EE-VQP-81 - Hierarchy / EE_QW_3_20080625