searching between two seperate files

How does the output file differ from "Zulu\n" followed by file 2?

Not too hard, very roughly:

f1 = fopen( "file1", "r" );
f2 = fopen( "file2", "r" );

fgets( Line, sizeof(Line), file1);
p = strchr( ',', Line );   // look for first comma
p = strchr( ',', Line[p]);  // look for second comma starting after first one
while( p > 0 ) {  // while we have a comma
  p2 = strchr( ',', Line[p] );   // find comma after keyqword
  if(p2 == 0 ) p2 = 999; else Line[ p+p2 ] = '\0';  // zero end the keyword
  strcpy( Key, Line[p] );    // make a copy of the keyword
  fseek( f2, 0, FILE_BEGIN );   // rewind the second file
  while( ! feof(f2) ) {   // scan whole file
     fgets( Line2, sizeof(Line2), f2 );  // read a line
     if( Line2[0] == '>' )
         p3 = strstr( Key, Line2 );  // look for key
     else p3 = 0;
     if( p3 > 0 ) {   // if we find the key
       do {  // copy lines til next '>'
          fgets( Line2, sizeof(Line2), f2 ) {
           if Line2[0] != '>' ) printf( "%s", Line2 );
      } while( Line2[0] ! = '>' && ! feof( f2 ) );
}
}
p = p2;  Skip to after keyword
p = strchr( ',', Line[p]);  // look for next comma
}

             

ozo is right, is

Zulu
>a*3008
12333
Zulu
>a*a2301
fdfdfd
Finn 90
>a*1232
asdfdfdf

what you mean? What's the corellation between the columns in file 1 and the data blocks in file 2?

The file differ in that its only one population per file, as opposed to many populations in one file

Ah - that means that the population you want to look for has to be known beforehand and you take all the fileds beginning with the 3rd and corellate them with the data in the 2nd?

yea the 3,4,6,7,9,10,12,13,15,16,18,19

An, OK. So you could

#include <iostream>
#include <fstream>
#include <string>
#include <list>
#include <map>
using namespace std;

string ExtractField ( unsigned int unRow, const string& sLine) {

    // find 'unRow' column

    int nPos = 0;
    int nCount = 0;

    while ( nCount < (unRow - 1)) { // 'unRow row' means 'unRow - 1 commas'

        nPos = sLine.find(',',nPos);

        if ( -1 == nPos) return false; // assume 'no match' if there is no such column

        ++nPos; ++nCount;
    }

    // find next delimiting comma

    if ( nPos >= sLine.size()) return false;

    int nEnd = sLine.find(',',nPos);

    if ( -1 == nEnd) return false; // assume 'no match' if there is no following comma

    string sField = sLine.substr(nPos, nEnd - nPos);

    return sField;
}

void ExtractHaplotypesForPopulation(const char* pszHaplotypeFileName, const string& sPop, list<string>& lstResult) {

    static int anFields[] = { 3,4,-1, 6,7,9,10,12,13,15,16,18,19, -1}; // TEST - remove the 1st -1

    ifstream is (pszHaplotypeFileName);

    string sLine;

    if (!is.is_open()) {

        cout << "Could not open input file" << endl;

        return;
    }

    while (!is.eof()) {

        getline(is,sLine);

        cout << "RAW " << sLine << endl;

        string sField = ExtractField (1,sLine);

        if (sField == sPop) {

            for ( int i = 0; anFields[i] > 0; ++i) {

                sField = ExtractField (anFields[i],sLine);

                cout << "    found " << sField << endl;

                while ( ' ' == sField[0]) sField.erase(0,1); // remove whitespace

                if (sField.size()) lstResult.push_back(sField);
            }
        }
    }
}

void ReadProteins(const char* pszProteinFileName, map<string,string>& mapProteins) {

    ifstream is (pszProteinFileName);

    string strLine;
    string strData;
    string strType;

    if (!is.is_open()) {

        cout << "Could not open input file" << endl;

        return;
    }

    while (!is.eof()) {

        int nPos;

        getline(is,strLine);
        cout << "RAW " << strLine << endl;

        if ( strLine[0] == '>') {

            strType = strLine.substr(1);

            cout << " found " << strType << endl;

            getline(is,strData);
            cout << "  adding " << strData << endl;;

            mapProteins.insert(map<string,string>::value_type(strType,strData));
            strData.erase(); // start out with a fresh buffer

        }
    }
}

void AssociateProteinsWithHaplotypes(const char* pszFileName, string sPop, list<string>& lstTypes, map<string,string>& mapProteins) {

    ofstream os (pszFileName);

    string strLine;
    string strData;
    string strType;

    if (!os.is_open()) {

        cout << "Could not open output file" << endl;

        return;
    }

    os << sPop << endl;

    list<string>::iterator il;

    for ( il = lstTypes.begin(); il != lstTypes.end(); ++il) {

        map<string,string>::iterator im = mapProteins.find(*il);

        if ( mapProteins.end() != im) {

            os << ">" << im->first << endl << im->second << endl;
        }
    }
}

int main () {

    string sPop;
    list<string> lstTypes;
    map<string,string> mapProteins;

    cout << "Enter Population: " << endl;
    cin >> sPop;

    ExtractHaplotypesForPopulation ( "pop.txt", sPop, lstTypes);
    ReadProteins ( "haplo.txt", mapProteins);

    AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);

    return 0;
}

With your sample above, it creates

zulu
>a*3008
12333
>a*1232
asdfdfdf
>a*3q43
asfdfdsf

Its not working right and I think becuase the population file is still that same mhc.csv file whilie the other is a text file

>> Its not working right

Could you be a little more precise?

Oh, and BTW - you might want to consider providing a portion of the original file.

And, did you follow the instructions in

    static int anFields[] = { 3,4,-1, 6,7,9,10,12,13,15,16,18,19, -1}; // TEST - remove the 1st -1

?

sorry for being so slack and getting back to you. the program would jsut crash each time. and the files are the same files we have been working with in previous questions.

>> the files are the same files we have been working with in previous questions.

Um, no - here, 'Zulu' is in the 1st field, 'mhc.csv' has it in the 3rd...

I modified the program we had in a previous question. You'll get the result by searching for a population.

Regards, Alex

#pragma warning (disable : 4786 4503)

#include <map>
#include <vector>
#include <string>
#include <sstream>
#include <fstream>
#include <iostream>
#include <windows.h>

using namespace std;

typedef vector<string>      Population;

typedef vector<Population*> PopulationSet;


class PopulationDatabase
{
    string                        filename1;  
    string                        filename2;  
    PopulationSet                 allPopulation;
    map<string, PopulationSet >   mapPopulation;
    map<string, PopulationSet >   mapPopArea;
    map<string, string >          mapHaploTypes;
public:
   
    PopulationDatabase(const string& file1, const string& file2 )
        : filename1(file1), filename2(file2) {}  
    ~PopulationDatabase();
    int readFromFiles();
    int parsePopulationRecord( const string& line, Population& array);

    int searchPop(const string& pop, PopulationSet& rset);
    int searchArea(const string& area, PopulationSet& rset);

    void displayRec(const Population&    rec);
    void displaySet(const PopulationSet& rset);
    void displayAll();
    void writeOutputfile(PopulationSet& rset);
};

PopulationDatabase::~PopulationDatabase()
{
    for (int i = 0; i < allPopulation.size(); ++i)
        delete allPopulation[i];
}

int PopulationDatabase::parsePopulationRecord( const string& line, Population& array)
{
   istringstream iss(line);
   string entry;
   string text;
   bool   literal = false;
   
   while (getline(iss, entry, ','))
   {
       if (literal)
       {
           if (entry.rfind('"') == entry.length()-1)
           {
               literal = false;
               entry.resize(entry.length()-1);
               text += entry;
               entry = text;
           }
           else
           {
              text += entry;
              text += ',';
              continue;
           }
       }
       else if (entry.find('"') == 0)
       {
           if (entry.rfind('"') == entry.length()-1)
               entry = entry.substr(1, entry.length()-2);
           else
           {
               literal = true;
               text = entry;
               text += ',';
               continue;
           }
       }
       array.push_back(entry);
   }
   return array.size();
}


int PopulationDatabase::readFromFiles()
{
   ifstream ifs(filename1.c_str(), ios::binary | ios::in);
   string line;
   line.reserve(1024);
   int count = 0;
   char c;
   while (ifs.read(&c, 1))
   {
       // check for end-of-line
       if (c == '\r' || c == '\n')
       {
           if (line.empty())
               continue;

           Population* pPop = new Population;
           pPop->reserve(30);
           int n = parsePopulationRecord(line, *pPop);
           if (n != 30)
           {
               cout << "Error: wrong number of commas in line " << count << endl;
               continue;  // ignore line
           }
           allPopulation.push_back(pPop);
           PopulationSet& setP = mapPopulation[(*pPop)[2]];  // get set from map Population
                                                             // can be a new empty set
           setP.push_back(pPop);
           PopulationSet& setA = mapPopArea[(*pPop)[3]];     // get set from map PopArea
           setA.push_back(pPop);                             // can be a new empty set
           line = "";
       }
       else
           line += c;  // add char to line
   }
   ifs.close();

   ifstream ifs2(filename2.c_str());
   string key, data;
   while (getline(ifs2, key) && getline(ifs2, data))
   {
       if (key.find('>') != 0)
           continue;
       mapHaploTypes[key] = data;
   }

   ifs2.close();
   return allPopulation.size();
}        

int PopulationDatabase::searchPop(const string& pop, PopulationSet& rset)
{
    rset = mapPopulation[pop];
    return rset.size();
}

int PopulationDatabase::searchArea(const string& area, PopulationSet& rset)
{
    rset = mapPopArea[area];
    return rset.size();
}

void PopulationDatabase::displayRec(const Population&    rec)
{
    for (int i = 0; i < rec.size(); ++i)
    {  
        cout << rec[i];
        if (i < rec.size()-1) cout << ',';
        else                  cout << endl;
    }
}

void PopulationDatabase::writeOutputfile(PopulationSet& rset)
{
    static int haploTypeCols[] = { 4,5,7,8,10,11,13,14,16,17,19,20 };

    ofstream ofs("output.txt");
    string pop;
    for (int i = 0; i < rset.size(); ++i)
    {
        Population& rec = *rset[i];
        if (rec[2] != pop)
        {
            pop = rec[2];
            ofs << rec[2] << endl;
        }
        for (int j = 0; j < sizeof(haploTypeCols)/sizeof(int); ++j)
        {  
            string key = ">";
            key += rec[haploTypeCols[j]];
            if (key == ">")
                continue;
            map<string, string>::iterator f = mapHaploTypes.find(key);
            if (f == mapHaploTypes.end())
                continue;

            ofs << key << endl << f->second << endl;
        }
    }
    ofs.close();
}

void PopulationDatabase::displaySet(const PopulationSet& rset)
{
    for (int i = 0; i < rset.size(); ++i)
        displayRec(*rset[i]);
}

void PopulationDatabase::displayAll()
{  
    displaySet(allPopulation);
}



int main()
{

    while (true)
    {
        string file1, file2;
        cout << "Enter Filename 1 ==>";
        getline(cin, file1);
        cout << "Enter Filename 2 ==>";
        getline(cin, file2);

        PopulationDatabase popDB(file1, file2);
        int npops = popDB.readFromFiles();
        if (npops == 0)
        {
            cout << "No entries in file " << file1 << " or file doesn't exist" << endl;
            cout << "Do you want to continue? ";
            string c;
            getline (cin, c);
            if (c == "y" || c == "Y")
                continue;
            break;
        }
        cout << "The database has " << npops << " entries" << endl << endl;

        while (true)
        {
            cout << endl;
            cout << "1 Display All" << endl;
            cout << "2 Search Population" << endl;
            cout << "3 Search Pop. Area" << endl;
            cout << "4 Exit" << endl;
            cout << endl << "Make Your Choice ==> ";
            string c;
            getline (cin, c);
            switch (*c.begin())
            {
            case '1': popDB.displayAll(); break;
            case '2':
                {
                   cout << "Enter the Population you want to Search for ==> ";
                   string pop;
                   getline(cin, pop, '\n');
                   PopulationSet rset;
                   int n = popDB.searchPop(pop, rset);
                   if (n == 0)
                       cout << "Your search for " << pop << " doesn't match any record" << endl;
                   else
                       cout << "Your search matches " << n << " records" << endl << endl;
                       popDB.displaySet(rset);
                       popDB.writeOutputfile(rset);
                   break;
                }
            case '3':
                {
                   cout << "Enter the Population Area you want to Search for ==> ";
                   string area;
                   getline(cin, area, '\n');
                   PopulationSet rset;
                   int n = popDB.searchArea(area, rset);
                   if (n == 0)
                       cout << "Your search for " << area << " doesn't match any record" << endl;
                   else
                       cout << "Your search matches " << n << " records" << endl << endl;
                       popDB.displaySet(rset);
                   break;
                }
            case '4':
                return 1;
            }
        }
    }

    return 0;
}

I placed the trim line function from the old program in jkr, but so that it would make zulu the first field but i frogot that the 2,5,8,11,14,17 columns are either blank or have infomrtion we dont want to search. Also the first row is of no help

So, using the original .csv file, we could just add '3' to the column numbers? Let me give that a try...

Yup, with changing that to

void ExtractHaplotypesForPopulation(const char* pszHaplotypeFileName, const string& sPop, list<string>& lstResult) {

   static int anFields[] = { 3,4,6,7,9,10,12,13,15,16,18,19, -1}; // TEST - remove the 1st -1

   ifstream is (pszHaplotypeFileName);

   string sLine;

   if (!is.is_open()) {

       cout << "Could not open input file " << pszHaplotypeFileName << endl;

       return;
   }

   while (!is.eof()) {

       getline(is,sLine);

       cout << "RAW " << sLine << endl;

       string sField = ExtractField (3,sLine);

       if (sField == sPop) {

           for ( int i = 0; anFields[i] > 0; ++i) {

               sField = ExtractField (anFields[i] + 2,sLine);

               cout << "    found " << sField << endl;

               while ( ' ' == sField[0]) sField.erase(0,1); // remove whitespace

               if (sField.size()) lstResult.push_back(sField);
           }
       }
   }
}

it seems to work. Using

>DRB1*1401
12333
>DRB1*1501
fdfdfd
>A*300101
asdfdfdf
>Cw*020201
asfdfdsf

as 'file2' and your mhc.csv yields

Zulu
>DRB1*1401
12333
>DRB1*1501
fdfdfd
>A*300101
asdfdfdf
>Cw*020201
asfdfdsf

so should i use the the trimline fucntion, or just go as you have it

I'd go with the above - it is IMHO better to keep the data intact and in the original format as long as possible.

the program still ends up crashing and windows has to exit it...

Well, it works here. At least what I posted above.... What code are you using exactly? (sorry for asking, but my crystal ball is on repair :o)

lol....i used exactly the code you gave me with the additions

This is what i have

#include <iostream>
#include <fstream>
#include <string>
#include <list>
#include <map>
using namespace std;



string ExtractField ( unsigned int unRow, const string& sLine) {

    // find 'unRow' column

    int nPos = 0;
    int nCount = 0;

    while ( nCount < (unRow - 1)) { // 'unRow row' means 'unRow - 1 commas'

        nPos = sLine.find(',',nPos);

        if ( -1 == nPos) return false; // assume 'no match' if there is no such column

        ++nPos; ++nCount;
    }

    // find next delimiting comma

    if ( nPos >= sLine.size()) return false;

    int nEnd = sLine.find(',',nPos);

    if ( -1 == nEnd) return false; // assume 'no match' if there is no following comma

    string sField = sLine.substr(nPos, nEnd - nPos);

    return sField;
}

void ExtractHaplotypesForPopulation(const char* pszHaplotypeFileName, const string& sPop, list<string>& lstResult) {

   static int anFields[] = { 3,4,6,7,9,10,12,13,15,16,18,19, -1}; // TEST - remove the 1st -1

   ifstream is (pszHaplotypeFileName);

   string sLine;

   if (!is.is_open()) {

       cout << "Could not open input file " << pszHaplotypeFileName << endl;

       return;
   }

   while (!is.eof()) {

       getline(is,sLine);

       cout << "RAW " << sLine << endl;

       string sField = ExtractField (3,sLine);

       if (sField == sPop) {

           for ( int i = 0; anFields[i] > 0; ++i) {

               sField = ExtractField (anFields[i] + 2,sLine);

               cout << "    found " << sField << endl;

               while ( ' ' == sField[0]) sField.erase(0,1); // remove whitespace

               if (sField.size()) lstResult.push_back(sField);
           }
       }
   }
}

void ReadProteins(const char* pszProteinFileName, map<string,string>& mapProteins) {

    ifstream is (pszProteinFileName);

    string strLine;
    string strData;
    string strType;

    if (!is.is_open()) {

        cout << "Could not open input file" << endl;

        return;
    }

    while (!is.eof()) {

        int nPos;

        getline(is,strLine);
        cout << "RAW " << strLine << endl;

        if ( strLine[0] == '>') {

            strType = strLine.substr(1);

//            cout << " found " << strType << endl;

            getline(is,strData);
            cout << "  adding " << strData << endl;;

            mapProteins.insert(map<string,string>::value_type(strType,strData));
            strData.erase(); // start out with a fresh buffer

        }
    }
}

void AssociateProteinsWithHaplotypes(const char* pszFileName, string sPop, list<string>& lstTypes, map<string,string>& mapProteins) {

    ofstream os (pszFileName);

    string strLine;
    string strData;
    string strType;

    if (!os.is_open()) {

        cout << "Could not open output file" << endl;

        return;
    }

    os << sPop << endl;

    list<string>::iterator il;

    for ( il = lstTypes.begin(); il != lstTypes.end(); ++il) {

        map<string,string>::iterator im = mapProteins.find(*il);

        if ( mapProteins.end() != im) {

            os << ">" << im->first << endl << im->second << endl;
        }
    }
}

int main () {
      string sPop;
        
 list<string> lstTypes;
    map<string,string> mapProteins;

    cout << "Enter Population: " << endl;
    cin >> sPop;

    ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
    ReadProteins ( "hla_nuc.fasta.txt", mapProteins);

    AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);

    return 0;
}

Runs fine where, giving the same result as above. What does "hla_nuc.fasta.txt" look like?

>HLA:HLA00001 A*010101
ATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACCCAGACCTGGGCGGGCTCCCACTCCATGAGGTATTTCTTCA
CATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCA
GAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCG
AACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACGGTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCC
TCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCAC
CAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAG
GAGACGCTGCAGCGCACGGACCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACC
CTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAA
GTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCCAAGCCCCTCACCCTGAGATGGGAGCTG
TCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTGATCACTGGAGCTGTGGTCGCTGCCGTGATGTGGAGGA
GGAAGAGCTCAGATAGAAAAGGAGGGAGTTACACTCAGGCTGCAAGCAGTGACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCTTGTAAAGTGTGA
>HLA:HLA01244 A*010102
GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGT
GCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATG
AAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACGGTTCTCACACCATCCAGATAATGTATGGCT
GCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGAC
CGCGGCGGACATGGCAGCTCAGATTACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGG
CTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG
>HLA:HLA01971 A*010103
ATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACCCAGACCTGGGCGGGCTCCCACTCCATGAGGTATTTCTTCA
CATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCA
GAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCG
AACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACGGTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCC
TCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCAC
CAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAG
GAGACGCTGCAGCGCACTGACCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACC
CTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAA
GTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCCAAGCCCCTCACCCTGAGATGGG
>HLA:HLA00002 A*0102
ATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACCCAGACCTGGGCGGGCTCCCACTCCATGAGGTATTTCTCCA
CATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCA
GAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCG
AACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACGGTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCC
TCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCAC
CAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAG
GAGACGCTGCAGCGCACGGACCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACC
CTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAA
GTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCCAAGCCCCTCACCCTGAGATGGGAGCTG
TCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTGATCACTGGAGCTGTGGTCGCTGCCGTGATGTGGAGGA
GGAAGAGCTCAGATAGAAAAGGAGGGAGTTACACTCAGGCTGCAAGCAGTGACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCTTGTAAAGTGTGA
>HLA:HLA00003 A*0103
GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGT
GCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATG
AAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACGGTTCTCACACCATCCAGATGATGTATGGCT
GCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGAC
CGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGG
CTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG
>HLA:HLA00004 A*0104N
ATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACCCAGACCTGGGCGGGCTCCCACTCCATGAGGTATTTCTTCA
CATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCA
GAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCG
AACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACGGTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCC
TCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCAC
CAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAG
GAGACGCTGCAGCGCACGGACCCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTAC
CCTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGA
AGTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCCAAGCCCCTCACCCTGAGATGGGAGCT
GTCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTGATCACTGGAGCTGTGGTCGCTGCCGTGATGTGGAGG
AGGAAGAGCTCAGATAGAAAAGGAGGGAGTTACACTCAGGCTGCAAGCAGTGACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCTTGTAAAGTGTGA
>HLA:HLA01031 A*0106
GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGT
GCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATG
AAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACGGTTCTCACACCATCCAGATAATGTATGGCT
GCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGAC
CGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGTTGAGAGCCTACCTGGAGGGCCGGTGCGTGGACGGG
CTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG
>HLA:HLA01208 A*0107
GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGT
GCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGAGGCCTGAGTATTGGGACCAGGAGACACGGAATGTG
AAGGCCCACTCACAGACTGACCGAGAGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGTTCTCACACCATCCAGATAATGTATGGCT
GCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGAC
CGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGG
CTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG

Even that works w/o any crash. Yet there are no results, since the file format is obviously *different* from what you specified.

my mistakes...

Well, that's not a big deal, you can take care of it using

void ReadProteins(const char* pszProteinFileName, map<string,string>& mapProteins) {

   ifstream is (pszProteinFileName);

   string strLine;
   string strData;
   string strType;

   if (!is.is_open()) {

       cout << "Could not open input file" << endl;

       return;
   }

   while (!is.eof()) {

       int nPos;

       getline(is,strLine);
       cout << "RAW " << strLine << endl;

       if ( strLine[0] == '>') {

           nPos = strLine.find(' ');

           if ( -1 == nPos) continue;

           strType = strLine.substr(nPos);

            cout << " found " << strType << endl;

           while ( '>' != (char) is.peek() && !is.eof()) {

                 getline(is,strLine);
                 cout << "    data " << strLine << endl;

                 strData += strLine;
           }

           cout << "  adding " << strData << endl;;

           mapProteins.insert(map<string,string>::value_type(strType,strData));
           strData.erase(); // start out with a fresh buffer

       }
   }
}

its still crashing i think the problem is somehwere in the read protein function, could it be something with the parenthesis

you cut and pasted the code that i put up there and it worked for you? im confused....

What is the output before the crash?

it shows raw, then found then crashes

>> you cut and pasted the code that i put up there and it worked for you? im confused....

Yes, exactly.

Could you post the first 10 lines of your 'mhc.csv'?

Source      Subject      Population      Pop. Area      HLA-A 1      HLA-A 2      mismatch      HLA-B 1      HLA-B 2      mismatch      HLA-C 1      HLA-C 2      mismatch      HLA-DRB1 1      HLA-DRB1 2      mismatch      HLA-DQA1 1      HLA-DQA1 2      mismatch      HLA-DQB1 1      HLA-DQB1 2      mismatch      HLA-DPA1 1      HLA-DPA1 2      mismatch      HLA-DPB1 1      HLA-DPB1 2      mismatch      Report      Authors
ZAFHAM      13W035395      Zulu      Sub-Saharan Africa                                                            DRB1*1401      DRB1*1501            DQA1*0102      DQA1*0102            DQB1*0602      DQB1*0602                              DPB1*0201      DPB1*040101            Zulu from Natal Province, South Africa       MG Hammond, D Middleton and D Anley
ZAFHAM      13W036237      Zulu      Sub-Saharan Africa      A*0301      A*300101            B*1503      B*4201            Cw*020201      Cw*1701                                                                                                      Zulu from Natal Province, South Africa       MG Hammond, D Middleton and D Anley
ZAFHAM      13W036248      Zulu      Sub-Saharan Africa      A*0205      A*290201            B*1801      B*4403            Cw*0202      Cw*0714                                                                                                      Zulu from Natal Province, South Africa       MG Hammond, D Middleton and D Anley
ZAFHAM      13W035619      Zulu      Sub-Saharan Africa      A*3002      A*6802            B*0702      B*3910                                                                                                                        Zulu from Natal Province, South Africa       MG Hammond, D Middleton and D Anley
ZAFHAM      13W035667      Zulu      Sub-Saharan Africa      A*0205      A*290201            B*1401      B*1503                                                                                                                        Zulu from Natal Province, South Africa       MG Hammond, D Middleton and D Anley
ZAFHAM      13W035411      Zulu      Sub-Saharan Africa                                                            DRB1*0802      DRB1*1104            DQA1*0102      DQA1*0401            DQB1*0301      DQB1*0602                              DPB1*0201      DPB1*040101            Zulu from Natal Province, South Africa       MG Hammond, D Middleton and D Anley
ZAFHAM      13W036348      Zulu      Sub-Saharan Africa      A*0211      A*330301            B*4403      B*520101            Cw*0701      Cw*120203                                                                                                      Zulu from Natal Province, South Africa       MG Hammond, D Middleton and D Anley
ZAFHAM      13W036259      Zulu      Sub-Saharan Africa      A*3402      A*6802            B*1510      B*4403            Cw*0407      Cw*0801                                                                                                      Zulu from Natal Province, South Africa       MG Hammond, D Middleton and D Anley
ZAFHAM      13W035437      Zulu      Sub-Saharan Africa                                                            DRB1*0701      DRB1*0701            DQA1*0201      DQA1*030101            DQB1*020101      DQB1*020101                              DPB1*040101      DPB1*1501            Zulu from Natal Province, South Africa       MG Hammond, D Middleton and D Anley

THERE ARE NO COMMAS IN THAT FILE! *smashingforeheadondesk*

*gnarf* OK, that feels better now. That's what I used:

Source,Subject,Population,Pop. Area,HLA-A 1,HLA-A 2,mismatch,HLA-B 1,HLA-B 2,mismatch,HLA-C 1,HLA-C 2,mismatch,HLA-DRB1 1,HLA-DRB1 2,mismatch,HLA-DQA1 1,HLA-DQA1 2,mismatch,HLA-DQB1 1,HLA-DQB1 2,mismatch,HLA-DPA1 1,HLA-DPA1 2,mismatch,HLA-DPB1 1,HLA-DPB1 2,mismatch,Report,Authors
ZAFHAM,13W035395,Zulu,Sub-Saharan Africa,,,,,,,,,,DRB1*1401,DRB1*1501,,DQA1*0102,DQA1*0102,,DQB1*0602,DQB1*0602,,,,,DPB1*0201,DPB1*040101,,"Zulu from Natal Province, South Africa ","MG Hammond, D Middleton and D Anley "
ZAFHAM,13W036237,Zulu,Sub-Saharan Africa,A*0301,A*300101,,B*1503,B*4201,,Cw*020201,Cw*1701,,,,,,,,,,,,,,,,,"Zulu from Natal Province, South Africa ","MG Hammond, D Middleton and D Anley "

>>>> THERE ARE NO COMMAS IN THAT FILE

As there could be spaces in column 4 'Population Area', the file couldn't be evaluated properly if there are no commas.  

Regards

wait they are commas i opened it in xcel, but its a csv file

>> wait they are commas

The above was your original mhc.csv from http:Q_21457847.html

What you posted now has one comma per line, and that's definitely in the wrong place.

Oh, and BTW, the reason for the crash is kinda odd - there was an error in 'ExtractField()' - the following will avoid a crash, but without commas in mhc.csv, it cannot work.

string ExtractField ( unsigned int unRow, const string& sLine) {

   // find 'unRow' column

   string sField = "";

   int nPos = 0;
   int nCount = 0;

   while ( nCount < (unRow - 1)) { // 'unRow row' means 'unRow - 1 commas'

       nPos = sLine.find(',',nPos);

       if ( -1 == nPos) return sField; // assume 'no match' if there is no such column

       ++nPos; ++nCount;
   }

   // find next delimiting comma

   if ( nPos >= sLine.size()) return false;

   int nEnd = sLine.find(',',nPos);

   if ( -1 == nEnd) return false; // assume 'no match' if there is no following comma

   sField = sLine.substr(nPos, nEnd - nPos);

   return sField;
}

when u open a csv file in excel it takes away all the commas cuz its in cells, however, the actually file if opened in a text editor will show commas

Well, then try the above change, or

#include <iostream>
#include <fstream>
#include <string>
#include <list>
#include <map>
using namespace std;



string ExtractField ( unsigned int unRow, const string& sLine) {

   // find 'unRow' column

   string sField = "";

   int nPos = 0;
   int nCount = 0;

   while ( nCount < (unRow - 1)) { // 'unRow row' means 'unRow - 1 commas'

       nPos = sLine.find(',',nPos);

       if ( -1 == nPos) return sField; // assume 'no match' if there is no such column

       ++nPos; ++nCount;
   }

   // find next delimiting comma

   if ( nPos >= sLine.size()) return false;

   int nEnd = sLine.find(',',nPos);

   if ( -1 == nEnd) return false; // assume 'no match' if there is no following comma

   sField = sLine.substr(nPos, nEnd - nPos);

   return sField;
}

void ExtractHaplotypesForPopulation(const char* pszHaplotypeFileName, const string& sPop, list<string>& lstResult) {

  static int anFields[] = { 3,4,6,7,9,10,12,13,15,16,18,19, -1}; // TEST - remove the 1st -1

  ifstream is (pszHaplotypeFileName);

  string sLine;

  if (!is.is_open()) {

      cout << "Could not open input file " << pszHaplotypeFileName << endl;

      return;
  }

  while (!is.eof()) {

      getline(is,sLine);

      cout << "RAW " << sLine << endl;

      string sField = ExtractField (3,sLine);

      if (sField == sPop) {

          for ( int i = 0; anFields[i] > 0; ++i) {

              sField = ExtractField (anFields[i] + 2,sLine);

              cout << "    found " << sField << endl;

              while ( ' ' == sField[0]) sField.erase(0,1); // remove whitespace

              if (sField.size()) lstResult.push_back(sField);
          }
      }
  }
}

void ReadProteins(const char* pszProteinFileName, map<string,string>& mapProteins) {

   ifstream is (pszProteinFileName);

   string strLine;
   string strData;
   string strType;

   if (!is.is_open()) {

       cout << "Could not open input file" << endl;

       return;
   }

   while (!is.eof()) {

       int nPos;

       getline(is,strLine);
       cout << "RAW " << strLine << endl;

       if ( strLine[0] == '>') {

           nPos = strLine.find(' ');

           if ( -1 == nPos) continue;

           strType = strLine.substr(nPos);

            cout << " found " << strType << endl;

//           getline(is,strData);

           while ( '>' != (char) is.peek() && !is.eof()) {

                 getline(is,strLine);
                 cout << "    data " << strLine << endl;

                 strData += strLine;
           }

           cout << "  adding " << strData << endl;;

           mapProteins.insert(map<string,string>::value_type(strType,strData));
           strData.erase(); // start out with a fresh buffer

       }
   }
}

void AssociateProteinsWithHaplotypes(const char* pszFileName, string sPop, list<string>& lstTypes, map<string,string>& mapProteins) {

   ofstream os (pszFileName);

   string strLine;
   string strData;
   string strType;

   if (!os.is_open()) {

       cout << "Could not open output file" << endl;

       return;
   }

   os << sPop << endl;

   list<string>::iterator il;

   for ( il = lstTypes.begin(); il != lstTypes.end(); ++il) {

       map<string,string>::iterator im = mapProteins.find(*il);

       if ( mapProteins.end() != im) {

           os << ">" << im->first << endl << im->second << endl;
       }
   }
}

int main () {
    string sPop;
     
 list<string> lstTypes;
   map<string,string> mapProteins;

   cout << "Enter Population: " << endl;
   cin >> sPop;

   ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
   ReadProteins ( "hla_nuc.fasta.txt", mapProteins);

   AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);

   return 0;
}

ok the program runs all the way through and makes the result file, except that it just says Zulu and thats it

Did you try the program I posted above? You simply need to create an empty Windows Console application in VC6 and add the file posted to the project tree.

The program ask for the file names and shows a menu where you can make queries. Choose '2' Population Query and type 'Zulu' . The output is written to file 'output.txt' on the current directory.

I wonder if it would output more than 'Zulu'.

Regards, Alex

When the data simply does not match, I'm sure it won't. The actual test data that was given yields correct results anyway...

>>>>> When the data simply does not match, I'm sure it won't.

Yes, I agree. It seems the spec of file 1 and/or file 2 still doesn't match the files actually used for testing.

Regards

its outputting the same thing on the screen

So, there's no match... one possible outcome of a search.

Try to feed it with test data, e.g.

>HLA:HLA01031 DRB1*1401
12333
>HLA:HLA01032 DRB1*1501
fdfdfd
>HLA:HLA01033 A*300101
asdfdfdf
>HLA:HLA01034 Cw*020201
asfdfdsf

as hla_nuc.fasta.txt and you'll see results.

same result, it will say iut searched the appropiate terms, but then in the output fil still just zulu, does it matter if the 2nd file is not a txt file

actually it shouldnt because thus it finds the matches in the hla_nuc file.  so i have no idea why its not matchin it up

>>does it matter if the 2nd file is not a txt file

What do you mean by "is not a text file"? You are posting it here, so it's text.
BTW, one problem with the transition from format spec

> DRB1*1401

to

>HLA:HLA01031 DRB1*1401

The space was not properly taken care of. With the above test data and

void ReadProteins(const char* pszProteinFileName, map<string,string>& mapProteins) {

   ifstream is (pszProteinFileName);

   string strLine;
   string strData;
   string strType;

   if (!is.is_open()) {

       cout << "Could not open input file" << endl;

       return;
   }

   while (!is.eof()) {

       int nPos;

       getline(is,strLine);
       cout << "RAW " << strLine << endl;

       if ( strLine[0] == '>') {

           nPos = strLine.find(' ');

           if ( -1 == nPos) continue;

           strType = strLine.substr(nPos + 1);

            cout << " found " << strType << endl;

//           getline(is,strData);

           while ( '>' != (char) is.peek() && !is.eof()) {

                 getline(is,strLine);
                 cout << "    data " << strLine << endl;

                 strData += strLine;
           }

           cout << "  adding " << strData << endl;;

           mapProteins.insert(map<string,string>::value_type(strType,strData));
           strData.erase(); // start out with a fresh buffer

       }
   }
}


the result is

   looking up DRB1*1401
      found entry: DRB1*1401
   looking up DRB1*1501
      found entry: DRB1*1501
   looking up DQA1*0102
   looking up DQA1*0102
   looking up DQB1*0602
   looking up DQB1*0602
   looking up A*0301
   looking up A*300101
      found entry: A*300101
   looking up B*1503
   looking up B*4201
   looking up Cw*020201
      found entry: Cw*020201
   looking up Cw*1701
 We searched the following entries:
  A*300101
  Cw*020201
  DRB1*1401
  DRB1*1501

and

Zulu
>DRB1*1401
12333
>DRB1*1501
fdfdfd
>A*300101
asdfdfdf
>Cw*020201
asfdfdsf

You should have spotted that, since you said that you are trying to understand code you've been given :o)

perfect, one more thing to ask, is there a way to make an option so that the user can specify if he wants to see the doubles or just show matches once

Win which of the files do you expect the 'doubles'?

well there are double occurences in the mhc.csv file

and also a way to print out all the populations at once with there matches

and also a way to print out all the populations at once with their matches in seperate files...so basically the first thing we worked on, but massed produced for all populations without having to specify the populations.  i am also working on the switch for it right  now

The 'mass produced' version would be to change 'main()' to

void Process ( string sPopulation, char* pszFastaFile, char* pszResult) {
    string sPop;
     
   list<string> lstTypes;
   map<string,string> mapProteins;

   ExtractHaplotypesForPopulation ( "mhc.csv", sPopulation, lstTypes);
   ReadProteins ( pszFastaFile, mapProteins);

   AssociateProteinsWithHaplotypes ( pszResult, sPop, lstTypes, mapProteins);

}

To remove the duplicates, just add a function like

void RemoveDuplicates (list<string>& lstTypes){

map<string,string> tmp;
map<string,string>::iterator im;
list<string>::iterator il;

   for ( il = lstTypes.begin(); il != lstTypes.end(); ++il) {

      tmp.insert(map<string,string>::value_type(*il,*il));
   }

   lstTypes.erase();

    for (im = tmp.begin(); tmp.end() != im; ++im) lstTypes.push_back(im->first);
}

and call that when you don't want any duplicates (right after 'ExtractHaplotypesForPopulation()')

it says it takes no parameter when i use the call line RemoveDuplicates(1st Types)

I have mentioned, something similar earlier already, but: could you post the relevant code? If you had already done that, I might have been able to provide the answer to the proble right now :o)

#include <iostream>
#include <fstream>
#include <string>
#include <list>
#include <map>
using namespace std;



string ExtractField ( unsigned int unRow, const string& sLine) {

   // find 'unRow' column

   string sField = "";

   int nPos = 0;
   int nCount = 0;

   while ( nCount < (unRow - 1)) { // 'unRow row' means 'unRow - 1 commas'

       nPos = sLine.find(',',nPos);

       if ( -1 == nPos) return sField; // assume 'no match' if there is no such column

       ++nPos; ++nCount;
   }

   // find next delimiting comma

   if ( nPos >= sLine.size()) return false;

   int nEnd = sLine.find(',',nPos);

   if ( -1 == nEnd) return false; // assume 'no match' if there is no following comma

   sField = sLine.substr(nPos, nEnd - nPos);

   return sField;
}
void RemoveDuplicates (list<string>& lstTypes){

map<string,string> tmp;
map<string,string>::iterator im;
list<string>::iterator il;

   for ( il = lstTypes.begin(); il != lstTypes.end(); ++il) {

      tmp.insert(map<string,string>::value_type(*il,*il));
   }

   lstTypes.erase();

    for (im = tmp.begin(); tmp.end() != im; ++im) lstTypes.push_back(im->first);
}


string GetPopulation(string& sPop)
{
      char* apszPopulations[] = {"Algerian 99","American Samoa","AmerIndian","Ami 97","Arab Durze","Atayal","Bari","Brazilian","Brazilian (Af Eu)","Bulgarian","Bunun","Burait","Cape York","Chaouya","Croatian","Cuban (Af Eu)","Cuban (Eu)","Czech","Doggon","Filipino","Finn 90","Georgian","Groote Eylandt","Guarani-Kaiowa","Guarani-Nandewa","Hakka","Han-Chinese 149","Han Chinese 572","Irish","Israeli Jews","Ivantan","Kenyan 142","Kenyan Highlander","Kenyan Lowlander","Kimberley","Korean 200","Kurdish","Malay","Mandenka","Metalsa","Mexican","Minnan","North America (Af)","North America (As)","North America (Eu)","North American (Hi)","Okinawan","Omani","Paiwan 51","Pazeh","Puyuma 49","Rukai","Ryukuan","Saisiat","Seri","Shona","Singapore","Siraya","Thai","Thao","Toroko","Tsou","Tuva","Ugandan","Yami","Yuendumu","Yupik","Zambian","Zulu", NULL};
      
      bool bFound =false;

      while(!bFound){
            cout<<"What is the name of the population you want to search for?"<<endl;
            cout<<"The search is case sensitive and you have to press enter twice."<<endl;
            getline(cin, sPop, '\n');
            for (int i=0; apszPopulations[i] !=NULL; ++i){
                  if (!sPop.compare(apszPopulations[i])){bFound = true; break;}
            }
            
      }
      return sPop;
}


void Process ( string sPopulation, char* pszFastaFile, char* pszResult) {
    string sPop;
     
   list<string> lstTypes;
   map<string,string> mapProteins;

   ExtractHaplotypesForPopulation ( "mhc.csv", sPopulation, lstTypes);
   ReadProteins ( pszFastaFile, mapProteins);

   AssociateProteinsWithHaplotypes ( pszResult, sPop, lstTypes, mapProteins);

}

void ExtractHaplotypesForPopulation(const char* pszHaplotypeFileName, const string& sPop, list<string>& lstResult) {

  static int anFields[] = { 3,4,6,7,9,10,12,13,15,16,18,19, -1}; // TEST - remove the 1st -1

  ifstream is (pszHaplotypeFileName);

  string sLine;

  if (!is.is_open()) {

      cout << "Could not open input file " << pszHaplotypeFileName << endl;

      return;
  }

  while (!is.eof()) {

      getline(is,sLine);

  //    cout << "RAW " << sLine << endl;

      string sField = ExtractField (3,sLine);

      if (sField == sPop) {

          for ( int i = 0; anFields[i] > 0; ++i) {

              sField = ExtractField (anFields[i] + 2,sLine);

   //           cout << "    found " << sField << endl;

              while ( ' ' == sField[0]) sField.erase(0,1); // remove whitespace

              if (sField.size()) lstResult.push_back(sField);
          }
      }
  }
}

void ReadProteins(const char* pszProteinFileName, map<string,string>& mapProteins) {

   ifstream is (pszProteinFileName);

   string strLine;
   string strData;
   string strType;

   if (!is.is_open()) {

       cout << "Could not open input file" << endl;

       return;
   }

   while (!is.eof()) {

       int nPos;

       getline(is,strLine);
//       cout << "RAW " << strLine << endl;

       if ( strLine[0] == '>') {

           nPos = strLine.find(' ');

           if ( -1 == nPos) continue;

           strType = strLine.substr(nPos + 1);

//            cout << " found " << strType << endl;

       getline(is,strData);

           while ( '>' != (char) is.peek() && !is.eof()) {

                 getline(is,strLine);
              //   cout << "    data " << strLine << endl;

                 strData += strLine;
           }

    //       cout << "  adding " << strData << endl;;

           mapProteins.insert(map<string,string>::value_type(strType,strData));
           strData.erase(); // start out with a fresh buffer

       }
   }
}
void AssociateProteinsWithHaplotypes(const char* pszFileName, string sPop, list<string>& lstTypes, map<string,string>& mapProteins) {

   ofstream os (pszFileName);

   string strLine;
   string strData;
   string strType;

   if (!os.is_open()) {

       cout << "Could not open output file" << endl;

       return;
   }

   os << sPop << endl;

   list<string>::iterator il;

   for ( il = lstTypes.begin(); il != lstTypes.end(); ++il) {

       cout << "   looking up " << *il << endl;
       map<string,string>::iterator im = mapProteins.find(*il);

       if ( mapProteins.end() != im) {

           os << ">" << im->first << endl << im->second << endl;
           cout << "      found entry: " << im->first << endl;
        }
   }

   map<string,string>::iterator im;

   cout << " We searched the following entries: " << endl;
   for (im = mapProteins.begin(); mapProteins.end() != im; ++im)
           cout << "  " << im->first << endl;

}

int main () {
    string sPop;
     
   list<string> lstTypes;
   map<string,string> mapProteins;

 cout<<"Available Populations:"<<endl;
      cout<<" "<<endl;
      cout<<"Algerian 99,            American Samoa,            AmerIndian,                  Ami 97"<<endl;
      cout<<"Arab Durze,            Atayal,                  Bari,                        Brazilian"<<endl;
      cout<<"Brazilian (Af Eu),      Bulgarian,            Bunun,                        Burait"<<endl;
      cout<<"Cape York,            Chaouya,            Croatian,                  Cuban (Af Eu)"<<endl;
      cout<<"Cuban (Eu),            Czech,                  Doggon,                        Filipino"<<endl;
      cout<<"Finn 90,            Georgian,            Groote Eylandt,                  Guarani-Kaiowa"<<endl;
      cout<<"Guarani-Nandewa,      Hakka,                  Han-Chinese 149                  Han Chinese 572"<<endl;
      cout<<"Irish,                  Israeli Jews,            Ivantan,                  Kenyan 142"<<endl;
      cout<<"Kenyan Highlander,      Kenyan Lowlander,      Kimberley,                  Korean 200"<<endl;
      cout<<"Kurdish,            Malay,                  Mandenka,                  Metalsa"<<endl;
      cout<<"Mexican                  Minnan                  North America (Af)            North America (As)"<<endl;
      cout<<"North America (Eu),      North American (Hi),      Okinawan,                  Omani"<<endl;
      cout<<"Paiwan 51,            Pazeh,                  Puyuma 49,                  Rukai"<<endl;
      cout<<"Ryukuan,            Saisiat,            Seri,                        Shona"<<endl;
      cout<<"Singapore,            Siraya,                  Thai,                        Thao"<<endl;
      cout<<"Toroko,                  Tsou,                  Tuva,                        Ugandan"<<endl;
      cout<<"Yami,                  Yuendumu,             Yupik,                        Zambian"<<endl;
      cout<<"Zulu"<<endl;
int choice;
cout<<"Below are your menu choices:"<<endl;
cout<<"[1] Show individual populations with frequency"<<endl;
cout<<"[2] Show individual populations without the frequency"<<endl;
cout<<"[3] Print out all populations with their alleles"<<endl;
cin>>choice;

switch(choice)
{
case 1:
      {
      GetPopulation(sPop);
      ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
      ReadProteins ( "hla_nuc.fasta", mapProteins);

      AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);
      }
case 2:
      {
      GetPopulation(sPop);
      ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
      RemoveDuplicates (1stTypes);
      AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);

      }
case 3:
      {
      }
default:
            cout << "Invalid Menu choice.  Please make another selection." << endl;
            system("cls");
            int main();
      return 0;
}
}

Well, one error on my side,

   lstTypes.erase();

should have been

   lstTypes.clear();

Then, you were missing the prototypes and there was also one typo ('1stTypes' instead of 'lstTypes'). The following compiles:

 #include <iostream>
#include <fstream>
#include <string>
#include <list>
#include <map>
using namespace std;

void ExtractHaplotypesForPopulation(const char* pszHaplotypeFileName, const string& sPop, list<string>& lstResult);
void ReadProteins(const char* pszProteinFileName, map<string,string>& mapProteins);
void AssociateProteinsWithHaplotypes(const char* pszFileName, string sPop, list<string>& lstTypes, map<string,string>& mapProteins);

string ExtractField ( unsigned int unRow, const string& sLine) {

  // find 'unRow' column

  string sField = "";

  int nPos = 0;
  int nCount = 0;

  while ( nCount < (unRow - 1)) { // 'unRow row' means 'unRow - 1 commas'

      nPos = sLine.find(',',nPos);

      if ( -1 == nPos) return sField; // assume 'no match' if there is no such column

      ++nPos; ++nCount;
  }

  // find next delimiting comma

  if ( nPos >= sLine.size()) return false;

  int nEnd = sLine.find(',',nPos);

  if ( -1 == nEnd) return false; // assume 'no match' if there is no following comma

  sField = sLine.substr(nPos, nEnd - nPos);

  return sField;
}
void RemoveDuplicates (list<string>& lstTypes){

map<string,string> tmp;
map<string,string>::iterator im;
list<string>::iterator il;

  for ( il = lstTypes.begin(); il != lstTypes.end(); ++il) {

     tmp.insert(map<string,string>::value_type(*il,*il));
  }

  lstTypes.clear();

   for (im = tmp.begin(); tmp.end() != im; ++im) lstTypes.push_back(im->first);
}


string GetPopulation(string& sPop)
{
    char* apszPopulations[] = {"Algerian 99","American Samoa","AmerIndian","Ami 97","Arab Durze","Atayal","Bari","Brazilian","Brazilian (Af Eu)","Bulgarian","Bunun","Burait","Cape York","Chaouya","Croatian","Cuban (Af Eu)","Cuban (Eu)","Czech","Doggon","Filipino","Finn 90","Georgian","Groote Eylandt","Guarani-Kaiowa","Guarani-Nandewa","Hakka","Han-Chinese 149","Han Chinese 572","Irish","Israeli Jews","Ivantan","Kenyan 142","Kenyan Highlander","Kenyan Lowlander","Kimberley","Korean 200","Kurdish","Malay","Mandenka","Metalsa","Mexican","Minnan","North America (Af)","North America (As)","North America (Eu)","North American (Hi)","Okinawan","Omani","Paiwan 51","Pazeh","Puyuma 49","Rukai","Ryukuan","Saisiat","Seri","Shona","Singapore","Siraya","Thai","Thao","Toroko","Tsou","Tuva","Ugandan","Yami","Yuendumu","Yupik","Zambian","Zulu", NULL};
   
     bool bFound =false;

    while(!bFound){
         cout<<"What is the name of the population you want to search for?"<<endl;
         cout<<"The search is case sensitive and you have to press enter twice."<<endl;
         getline(cin, sPop, '\n');
         for (int i=0; apszPopulations[i] !=NULL; ++i){
              if (!sPop.compare(apszPopulations[i])){bFound = true; break;}
         }
         
    }
    return sPop;
}


void Process ( string sPopulation, char* pszFastaFile, char* pszResult) {
   string sPop;
   
   list<string> lstTypes;
  map<string,string> mapProteins;

  ExtractHaplotypesForPopulation ( "mhc.csv", sPopulation, lstTypes);
  ReadProteins ( pszFastaFile, mapProteins);

  AssociateProteinsWithHaplotypes ( pszResult, sPop, lstTypes, mapProteins);

}

void ExtractHaplotypesForPopulation(const char* pszHaplotypeFileName, const string& sPop, list<string>& lstResult) {

 static int anFields[] = { 3,4,6,7,9,10,12,13,15,16,18,19, -1}; // TEST - remove the 1st -1

 ifstream is (pszHaplotypeFileName);

 string sLine;

 if (!is.is_open()) {

     cout << "Could not open input file " << pszHaplotypeFileName << endl;

     return;
 }

 while (!is.eof()) {

     getline(is,sLine);

 //    cout << "RAW " << sLine << endl;

     string sField = ExtractField (3,sLine);

     if (sField == sPop) {

         for ( int i = 0; anFields[i] > 0; ++i) {

             sField = ExtractField (anFields[i] + 2,sLine);

  //           cout << "    found " << sField << endl;

             while ( ' ' == sField[0]) sField.erase(0,1); // remove whitespace

             if (sField.size()) lstResult.push_back(sField);
         }
     }
 }
}

void ReadProteins(const char* pszProteinFileName, map<string,string>& mapProteins) {

  ifstream is (pszProteinFileName);

  string strLine;
  string strData;
  string strType;

  if (!is.is_open()) {

      cout << "Could not open input file" << endl;

      return;
  }

  while (!is.eof()) {

      int nPos;

      getline(is,strLine);
//       cout << "RAW " << strLine << endl;

      if ( strLine[0] == '>') {

          nPos = strLine.find(' ');

          if ( -1 == nPos) continue;

          strType = strLine.substr(nPos + 1);

//            cout << " found " << strType << endl;

      getline(is,strData);

          while ( '>' != (char) is.peek() && !is.eof()) {

                getline(is,strLine);
             //   cout << "    data " << strLine << endl;

                strData += strLine;
          }

   //       cout << "  adding " << strData << endl;;

          mapProteins.insert(map<string,string>::value_type(strType,strData));
          strData.erase(); // start out with a fresh buffer

      }
  }
}
void AssociateProteinsWithHaplotypes(const char* pszFileName, string sPop, list<string>& lstTypes, map<string,string>& mapProteins) {

  ofstream os (pszFileName);

  string strLine;
  string strData;
  string strType;

  if (!os.is_open()) {

      cout << "Could not open output file" << endl;

      return;
  }

  os << sPop << endl;

  list<string>::iterator il;

  for ( il = lstTypes.begin(); il != lstTypes.end(); ++il) {

      cout << "   looking up " << *il << endl;
      map<string,string>::iterator im = mapProteins.find(*il);

      if ( mapProteins.end() != im) {

          os << ">" << im->first << endl << im->second << endl;
          cout << "      found entry: " << im->first << endl;
       }
  }

  map<string,string>::iterator im;

  cout << " We searched the following entries: " << endl;
  for (im = mapProteins.begin(); mapProteins.end() != im; ++im)
          cout << "  " << im->first << endl;

}

int main () {
   string sPop;
   
   list<string> lstTypes;
  map<string,string> mapProteins;

cout<<"Available Populations:"<<endl;
    cout<<" "<<endl;
    cout<<"Algerian 99,          American Samoa,          AmerIndian,               Ami 97"<<endl;
    cout<<"Arab Durze,          Atayal,               Bari,                    Brazilian"<<endl;
    cout<<"Brazilian (Af Eu),     Bulgarian,          Bunun,                    Burait"<<endl;
    cout<<"Cape York,          Chaouya,          Croatian,               Cuban (Af Eu)"<<endl;
    cout<<"Cuban (Eu),          Czech,               Doggon,                    Filipino"<<endl;
    cout<<"Finn 90,          Georgian,          Groote Eylandt,               Guarani-Kaiowa"<<endl;
    cout<<"Guarani-Nandewa,     Hakka,               Han-Chinese 149               Han Chinese 572"<<endl;
    cout<<"Irish,               Israeli Jews,          Ivantan,               Kenyan 142"<<endl;
    cout<<"Kenyan Highlander,     Kenyan Lowlander,     Kimberley,               Korean 200"<<endl;
    cout<<"Kurdish,          Malay,               Mandenka,               Metalsa"<<endl;
    cout<<"Mexican               Minnan               North America (Af)          North America (As)"<<endl;
    cout<<"North America (Eu),     North American (Hi),     Okinawan,               Omani"<<endl;
    cout<<"Paiwan 51,          Pazeh,               Puyuma 49,               Rukai"<<endl;
    cout<<"Ryukuan,          Saisiat,          Seri,                    Shona"<<endl;
    cout<<"Singapore,          Siraya,               Thai,                    Thao"<<endl;
    cout<<"Toroko,               Tsou,               Tuva,                    Ugandan"<<endl;
    cout<<"Yami,               Yuendumu,           Yupik,                    Zambian"<<endl;
    cout<<"Zulu"<<endl;
int choice;
cout<<"Below are your menu choices:"<<endl;
cout<<"[1] Show individual populations with frequency"<<endl;
cout<<"[2] Show individual populations without the frequency"<<endl;
cout<<"[3] Print out all populations with their alleles"<<endl;
cin>>choice;

switch(choice)
{
case 1:
    {
    GetPopulation(sPop);
    ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
    ReadProteins ( "hla_nuc.fasta", mapProteins);

    AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);
    }
case 2:
    {
    GetPopulation(sPop);
    ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
    RemoveDuplicates (lstTypes);
    AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);

    }
case 3:
    {
    }
default:
         cout << "Invalid Menu choice.  Please make another selection." << endl;
         system("cls");
         int main();
    return 0;
}
}

witht that code i get a weird run with my getpopulation function.  it outputs the lines asking for the population twice and i think this is i get no output

So what is it that you expect as opposed to what you get?

HINT: If you merely say "It doesn't work", you are not really giving away a lot of useful information.

im expecting that in the result file i should have a fileall the matches appearing once, instead of duplicates like we get now

Also with the mass produced version, can each population display its matches in a seperate file with that population named....so zulu would have its matches, finn 90 would have its matches, etc etc

sorry i got the code to work for option two, however, it deletes any reoccurences instead of leaving one copy

I think wat is wrong wit the second option it just looks for anything that appears twice, and deletes all occurences of it.  ANd i cant figure it out enough to get it to only delete reoccurences, not the first copy

jkr...i really need ur help...where did u go?

Well, I have some work to do also. What compiler are you using at the moment? (I am asking because the issue "weird run with my getpopulation function seems to be related to a bug in VC6' STL")

it is being run in microsofI ma using microsoft visiual studio c++, if you need more information about the compiler just let me know

Tr<

string GetPopulation(string& sPop)
{
   char* apszPopulations[] = {"Algerian 99","American Samoa","AmerIndian","Ami 97","Arab Durze","Atayal","Bari","Brazilian","Brazilian (Af Eu)","Bulgarian","Bunun","Burait","Cape York","Chaouya","Croatian","Cuban (Af Eu)","Cuban (Eu)","Czech","Doggon","Filipino","Finn 90","Georgian","Groote Eylandt","Guarani-Kaiowa","Guarani-Nandewa","Hakka","Han-Chinese 149","Han Chinese 572","Irish","Israeli Jews","Ivantan","Kenyan 142","Kenyan Highlander","Kenyan Lowlander","Kimberley","Korean 200","Kurdish","Malay","Mandenka","Metalsa","Mexican","Minnan","North America (Af)","North America (As)","North America (Eu)","North American (Hi)","Okinawan","Omani","Paiwan 51","Pazeh","Puyuma 49","Rukai","Ryukuan","Saisiat","Seri","Shona","Singapore","Siraya","Thai","Thao","Toroko","Tsou","Tuva","Ugandan","Yami","Yuendumu","Yupik","Zambian","Zulu", NULL};
   
    bool bFound =false;


   while(!bFound){
        cout<<"What is the name of the population you want to search for?"<<endl;
        cout<<"The search is case sensitive and you have to press enter twice."<<endl;
        cin >> sPop;

        for (int i=0; apszPopulations[i] !=NULL; ++i){
             if (!sPop.compare(apszPopulations[i])){bFound = true; break;}
        }
       
    }
   return sPop;
}

instead, that should also work with VC6. (cross-checked it)

That fixed one problem, however, with option 2 i am still not getin the right output.  It wont show the outputs of matches that come up more than once.  meaning that your code instead of leaving just one occurence in the output file, deleted all occurences of it

You need to put a 'break;' after each case, e.g.

switch(choice)
{
case 1:
   {
   GetPopulation(sPop);
   ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
   ReadProteins ( "hla_nuc.fasta", mapProteins);

   AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);
   break; // <-------
   }
case 2:
   {
   GetPopulation(sPop);
   ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
   RemoveDuplicates (lstTypes);
   AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);
   break; // <-------

   }
case 3:
   {
   }
default:
        cout << "Invalid Menu choice.  Please make another selection." << endl;
        //system("cls");
        int main(); // <-------------------What's that for?
   return 0;
}

i had the breaks in already adn the int main is so that the program will restart if the user puts the wrong input in.

do you have any thoughts as far as why the remove duplicates function takes away all the occurences of matches that have doubles?

Err, yes, because it is designed that way. That's what you asked for. It does not matter if you remove duplicates before finding the matches or afterwards - it might speed up the search, but the result will be the same.

well what im sayin is i would like to have at one cop of the duplicates in the output file

for example a sample output of option one is

>blah A*0101
dfdfdsfdsf
>blah A*0101
dfdfdsfdsf

well in option two i dont wnat to delete both occurences of the matches, rather, just make it so that it shows one match so it would be

>blah A*0101
dfdfdsfdsf

Hm, IMO that's what it does. However, you forgot to read the proteins in 'case 2':

   GetPopulation(sPop);
   ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
   RemoveDuplicates (lstTypes);
   ReadProteins ( "hla_nuc.fasta", mapProteins); // was missing
   AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);
   break; // <-------

If you are going to use all that in the same 'main()', be also sure to clear the containers, e.g.

   lstTypes.clear();
   MapProteins.clear();
   GetPopulation(sPop);
   ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
   RemoveDuplicates (lstTypes);
   ReadProteins ( "hla_nuc.fasta.txt", mapProteins); // was missing
   AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);
   break; // <-------

i have that too in my code, I guess when i cut and pasted, I did something wrong

Well, then it should work - at least here it does:

List before: DRB1*1401
List before: DRB1*1501
List before: DQA1*0102
List before: DQA1*0102
List before: DQB1*0602
List before: DQB1*0602
List before: A*0301
List before: A*300101
List before: B*1503
List before: B*4201
List before: Cw*020201
List before: Cw*1701
List after: A*0301
List after: A*300101
List after: B*1503
List after: B*4201
List after: Cw*020201
List after: Cw*1701
List after: DQA1*0102
List after: DQB1*0602
List after: DRB1*1401
List after: DRB1*1501
   looking up A*0301
   looking up A*300101
   looking up B*1503
   looking up B*4201
   looking up Cw*020201
   looking up Cw*1701
   looking up DQA1*0102
   looking up DQB1*0602
   looking up DRB1*1401
   looking up DRB1*1501
 We searched the following entries
  A*010102
  A*010103
  A*0102
  A*0103
  A*0104N
  A*0106

Are you sure you are using the right file when compiling?

I mean its givine me output dont get me wrong, but the peoblem is it takes out all ocurences of anything is a double.  Like make a test file with nothin but duplicates and Im sure once you run the program you wil get an empty output file.

Also did you see my notes earlier about the mass produce and how I would like the matches for each population to be printed into a seperate file named appropiately

>> but the peoblem is it takes out all ocurences of anything is a double

No. As you can see above:

List before: DQB1*0602
List before: DQB1*0602

vs.

List after: DQB1*0602

>>Also did you see my notes earlier about the mass produce and how I would like the matches for each population to be printed into a seperate file named
>>appropiately

Yes, but I wonder how that is related to the original question, which was "I would like to create a piece of code that would work with the rest of the program I have been developing." Now we're at a stage that to me resembles "I want you to add a couple of more features that also came into my mind"

well would you like for me to open a new post so that more points could be awarded?

As soon as we got the basic issue fixed, yes (also because this page becomes a pain to load with ~200kb now). Have you verified that removing the duplicates wors (at least the way you described the functionality)?. Oh, and one basic point before I forget about that, regarding your menu

while (1)
{
switch(choice)
{
case 1:
   {
   lstTypes.clear();
   mapProteins.clear();
    GetPopulation(sPop);
   ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
   ReadProteins ( "hla_nuc.fasta.txt", mapProteins);

   AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);
   break; // <-------
   }
case 2:
   {
   lstTypes.clear();
   mapProteins.clear();
   GetPopulation(sPop);
   ExtractHaplotypesForPopulation ( "mhc.csv", sPop, lstTypes);
   RemoveDuplicates (lstTypes);
   ReadProteins ( "hla_nuc.fasta.txt", mapProteins);
   AssociateProteinsWithHaplotypes ( "result.txt", sPop, lstTypes, mapProteins);
   break; // <-------

   }
case 3:
   {
   }

case 4: // exit loop
   {
      exit(0);
   }
default:
        cout << "Invalid Menu choice.  Please make another selection." << endl;
}
}

that still does not work....and I relaly dont knwo how to explain it differently than how i have before, maybe its the numbering because the one im looking for is A*0101 and the lowest match it picks up is A*0202?  I have no idea

owever, it is picking up at least one occurence

Well, it works in terns of eliminating duplicate entries previously extracted from the .csv file. If there are still no results when matching the entries against the other file, removing teh duplicates certainly isn't responsible for that. Compare the results when you run it with and without removing the duplicates.

Your right its on niether, so i dont know what to do and I dont know why its not picking it up

Ok well I think i figured out what the problem was, it was something on my end.  So I will have to take care of that.  I will award the points and move on for my next question

Thanx :o)