troubleshooting Question

Problems w/ str_replace()

Avatar of cdromes
cdromes asked on
PHP
3 Comments1 Solution290 ViewsLast Modified:
Howdy

I'm using the following code to open a file and read it one line at a time:

$Seq_File = fopen("/home/websites/genework/html/DATA/$Motif", "r");
while (!feof($Seq_File))
{
      $line = fgets($Seq_File);
      str_replace('{','<b>',$line);
        str_replace('}','</b>',$line);
...
...

Here's the sequence it's getting from the file:

TCTTCGTCTTCTAACAGAGAATGGTCATCATCTTTATTACTGTCGCCAAAGGTGGATTGTCCAAGTAAAA
CCTTTTCCCTTTTAGAAGCAAAATCATCAACTTCGTTTAAACCATACGGATTAATCTCATCCCCAACTTC
AGAGGTCTTAGTTCTGTTTGAGCCTTTGCGTACCATATTATTCTATACACCCACTCTAATATGTTTTCTC
TTCCTCCAAAACTTTTTGTATAAAAGCATCAGTGAGATGAGCTATGATGAGATGAGCTTCATTATTGAA{
TTTTTT}TTCATTGCAGAAGCGCAGTTTGAAAATTTTTCATCCGCCCTGCAAAGTCCAA{TTTTTT}GAT
CAGCAGAAGATAATGACCAGAGAATTATGGTATTCAAGAGAACAATTCAAAAGAGGACAGCTAGAAAGAT
ATTGAGGTATTTATAATTTGCTAGACTAACCGAAAGTCGAAGCGTAATCTTG{TTTTTT}ATTAAGCGGG
ATAGCATTCATTAAGT

The end of each line includes a \n and I'm wondering if this is why the str_replace() I'm attempting isn't working.  
Join the community to see this answer!
Join our exclusive community to see this answer & millions of others.
Unlock 1 Answer and 3 Comments.
Join the Community
Learn from the best

Network and collaborate with thousands of CTOs, CISOs, and IT Pros rooting for you and your success.

Andrew Hancock - VMware vExpert
See if this solution works for you by signing up for a 7 day free trial.
Unlock 1 Answer and 3 Comments.
Try for 7 days

”The time we save is the biggest benefit of E-E to our team. What could take multiple guys 2 hours or more each to find is accessed in around 15 minutes on Experts Exchange.

-Mike Kapnisakis, Warner Bros