DNA validation

I'm trying to write a perl script in the form of a loop which basically scans through a sequence:

$dna =
acgcatgcatcagtcagatcgtacgatagXagtagtgatgatatg
cagtcagtacgPcagactgcatagctQcagtacgactcgatata

you'll notice in a dna sequence of a's c's g's and t's there are anomolies in $dna. I'm trying to write a loop which recognises all characters that arn't a c g or t and change them to "a" by default. Basically add some validation to sequence scanning.

Thanks.