Solved

DNA validation

Posted on 2009-05-15
1
208 Views
Last Modified: 2012-05-07
I'm trying to write a perl script in the form of a loop which basically scans through a sequence:

$dna =
acgcatgcatcagtcagatcgtacgatagXagtagtgatgatatg
cagtcagtacgPcagactgcatagctQcagtacgactcgatata

you'll notice in a dna sequence of a's c's g's and t's there are anomolies in $dna. I'm trying to write a loop which recognises all characters that arn't a c g or t and change them to "a" by default. Basically add some validation to sequence scanning.

Thanks.
0
Comment
Question by:StephenMcGowan
[X]
Welcome to Experts Exchange

Add your voice to the tech community where 5M+ people just like you are talking about what matters.

  • Help others & share knowledge
  • Earn cash & points
  • Learn & ask questions
1 Comment
 
LVL 39

Accepted Solution

by:
Adam314 earned 500 total points
ID: 24397686

$dna =~ s/[^acgt]/a/g;

Open in new window

0

Featured Post

Free Tool: Subnet Calculator

The subnet calculator helps you design networks by taking an IP address and network mask and returning information such as network, broadcast address, and host range.

One of a set of tools we're offering as a way of saying thank you for being a part of the community.

Question has a verified solution.

If you are experiencing a similar issue, please ask a related question

Suggested Solutions

I've just discovered very important differences between Windows an Unix formats in Perl,at least 5.xx.. MOST IMPORTANT: Use Unix file format while saving Your script. otherwise it will have ^M s or smth likely weird in the EOL, Then DO NOT use m…
Checking the Alert Log in AWS RDS Oracle can be a pain through their user interface.  I made a script to download the Alert Log, look for errors, and email me the trace files.  In this article I'll describe what I did and share my script.
Explain concepts important to validation of email addresses with regular expressions. Applies to most languages/tools that uses regular expressions. Consider email address RFCs: Look at HTML5 form input element (with type=email) regex pattern: T…

752 members asked questions and received personalized solutions in the past 7 days.

Join the community of 500,000 technology professionals and ask your questions.

Join & Ask a Question