Solved

DNA validation

Posted on 2009-05-15
1
194 Views
Last Modified: 2012-05-07
I'm trying to write a perl script in the form of a loop which basically scans through a sequence:

$dna =
acgcatgcatcagtcagatcgtacgatagXagtagtgatgatatg
cagtcagtacgPcagactgcatagctQcagtacgactcgatata

you'll notice in a dna sequence of a's c's g's and t's there are anomolies in $dna. I'm trying to write a loop which recognises all characters that arn't a c g or t and change them to "a" by default. Basically add some validation to sequence scanning.

Thanks.
0
Comment
Question by:StephenMcGowan
1 Comment
 
LVL 39

Accepted Solution

by:
Adam314 earned 500 total points
ID: 24397686

$dna =~ s/[^acgt]/a/g;

Open in new window

0

Featured Post

Is Your Active Directory as Secure as You Think?

More than 75% of all records are compromised because of the loss or theft of a privileged credential. Experts have been exploring Active Directory infrastructure to identify key threats and establish best practices for keeping data safe. Attend this month’s webinar to learn more.

Question has a verified solution.

If you are experiencing a similar issue, please ask a related question

Suggested Solutions

Title # Comments Views Activity
Most Common two letters at the start of a word. 1 85
Connecting to linux server using Net::Telnet module 25 220
Perl string filter 5 73
quoting a comma separated list 20 82
Many time we need to work with multiple files all together. If its windows system then we can use some GUI based editor to accomplish our task. But what if you are on putty or have only CLI(Command Line Interface) as an option to  edit your files. I…
I have been pestered over the years to produce and distribute regular data extracts, and often the request have explicitly requested the data be emailed as an Excel attachement; specifically Excel, as it appears: CSV files confuse (no Red or Green h…
Explain concepts important to validation of email addresses with regular expressions. Applies to most languages/tools that uses regular expressions. Consider email address RFCs: Look at HTML5 form input element (with type=email) regex pattern: T…
This Micro Tutorial will teach you how to censor certain areas of your screen. The example in this video will show a little boy's face being blurred. This will be demonstrated using Adobe Premiere Pro CS6.

911 members asked questions and received personalized solutions in the past 7 days.

Join the community of 500,000 technology professionals and ask your questions.

Join & Ask a Question

Need Help in Real-Time?

Connect with top rated Experts

17 Experts available now in Live!

Get 1:1 Help Now